- To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.. - The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.. - Among them, 328 microRNAs were accepted as expressed genes in liver after filtering and were subjected to DE microRNAs analysis (Fig. - there were larger proportion of DE microRNAs in EX (12.0%, 38microRNAs) and HF group (13.5%, 39microRNAs) than in CR group (Fig. - Among DE microRNAs in CR group, 80.8% were found to be up-regulated and only 5 microRNAs were identi- fied down-regulated. - The DE microRNAs in each group were shown in Fig. - Most of the DE microRNAs chan- ged moderately. - 3d): mmu-miR-380-5p and mmu-miR-697 were up- regulated by CR and EX and down-regulated by HF;. - After normalized and filtered as mentioned in Methods, DE microRNAs were identified. - DE microRNAs in each lifestyle modification mice model were shown in a, b and c. - The numbers and names of DE microRNAs existed in two or three lifestyle modification mice models were shown in d. - DE microRNAs are low abundant genes in all the groups. - only and 15.4% DE microRNAs are high abundant genes in AL, CR, EX and HF group, respectively (Fig. - 92.3% (24 of 26) DE microRNAs changed after CR have only medium to low or even very low abundance in both CR and AL groups, and almost half (12 of 26) DE microRNAs have low or very low abundance in both groups. - Among the DE microRNAs changed after EX, only 1 microRNA has high abundance and 5 had medium abundance in both EX and AL groups. - On the other hand, almost half (18 of 39) DE microRNAs in HF have medium to high abundance in both HF and AL groups. - Representative microRNAs were validated in an inde- pendent platform - RT-qPCR, including DE microRNAs in all the three lifestyle modifications, such as such as mmu-miR-34a-5p, mmu-miR-99a-5p, mmu-miR-200b- 5p, mmu-miR-96-5p and mmu-miR-802-5p in CR group (Fig. - 5a), mmu-miR-200b-5p, mmu-miR-380-5p, mmu- miR-683 and mmu-miR-409-3p in EX group (Fig. - 5b), and mmu-miR-487b-3p, mmu-miR-380-5p, mmu-let-7e- 5p, mmu-miR-455-3p and mmu-miR-141-3p in HF. - To better understand the function of DE microRNAs in livers after lifestyle modifications, it is essential to iden- tify their target genes. - In this study, as described in Methods, we used four softwares to predict target genes and the intersections of the output results of at least three algorithms were used as prediction results for the DE microRNAs. - A total of 853 mRNAs were identified as potential targets for the total 84 DE microRNAs from the three treatments.. - To determine the functions and connections of the DE microRNAs in these lifestyle modification mice models, we applied enrichment analyses to clarify the biological function of microRNA integrated-signature via target genes. - These most striking cat- egories of gene function and main biochemical and signal transduction pathways will point us in the direc- tion of further research about DE microRNAs.. - In addition, we also predicted the potential functions of DE microRNAs by GO and KEGG analysis.. - 4 Expression level distributions of the accepted microRNAs and differentially expressed microRNAs. - Median normalized expression levels of all the microRNAs after normalized and filtered in each group and the DE microRNAs in each group. - The DE microRNAs median normalized expression levels in the two compared groups. - Many researchers commonly used microarrays to screen DE microRNAs in various pathophysiological processes [21]. - In addition, in this study, 4 ~ 6 DE microRNAs identified by micro- array in each lifestyle treatment were verified via RT- qPCR. - on the other hand, most of the DE microRNAs changed within a small range. - Among the three lifestyles, CR had the mildest impact on microRNAs, DE microRNAs in EX changed to the biggest range. - In addition, our results showed some common DE microRNAs between different lifestyle modifications. - In the brain of CR mice, there is a decreased expression of mmu-miR-34a [35]. - Another example is mmu-miR-200b-5p, which was up-regulated by both CR and EX in the present study. - Consistent with our findings, mmu-miR-200b-5p was also elevated in salivary post-running [36]. - Besides, we also presented that targets of DE microRNAs in different life- style modification were also enriched in some different functions or pathways. - Interestingly, we validated the expression change of a predicted target of mmu-miR- 802-5p and mmu-miR-96-5p, Elovl2, in CR. - Lamp2, another predicted target of mmu- miR-802-5p and mmu-miR-96-5p, belongs to autoph- agy–lysosome system and also reduces in liver of CR mice. - Although there are some limitations in our study, such as a relatively small sample size, we confirmed some of the DE microRNAs and predicted targets with RT-qPCR. - We pre- sented similarity and differences of DE microRNAs among them. - While our findings provide us with an overall vision of microRNAs in the molecular impact of lifestyles on health, further studies are required to de- cipher the underlying molecular mechanisms of these DE microRNAs.. - Elovl2 mmu-miR-802-5p,. - mmu-miR-96-5p. - Lamp2 mmu-miR-802-5p,. - Atp6v0a1 mmu-let-7e-5p, mmu-miR-34a-5p. - mmu-miR-34a-5p, mmu-miR-455-3p, mmu-miR-141-3p. - Target predictions for differentially expressed microRNAs Target prediction for the DE microRNAs was performed using Targetscan Mouse release 7.1, miRanda, miRDB and miRWalk2.0 [53–56]. - To improve the accuracy of target gene prediction and reduce the rate of false posi- tives, the intersections of the output results of at least three algorithms were used as prediction results for the DE microRNAs. - The predicted targets of DE microRNAs of each group were separately submitted to DAVID for an- notation and enrichment analyses. - The online version contains supplementary material available at https://doi.. - org/10.1186/s . - miRNA mmu-miR-141-3p CGCTAACACTGTCTGGTAAAGATGG mmu-miR-200b-5p CATCTTACTGGGCAGCATTGGA mmu-miR-34a-5p TGGCAGTGTCTTAGCTGGTTG mmu-miR-380-5p CGATGGTTGACCATAGAACATGCG mmu-miR-409-3p CCGAATGTTGCTCGGTGAACC mmu-miR-455-3p GCAGTCCACGGGCATATACAC mmu-miR-487b-3p CAATCGTACAGGGTCATCCACTT mmu-miR-683 CCTGCTGTAAGCTGTGTCCTC mmu-miR-802-5p GGCCTCAGTAACAAAGATTCATCCTT mmu-miR-96-5p GTTTGGCACTAGCACATTTTTGCT mmu-miR-99a-5p CAACCCGTAGATCCGATCTTGTG mmu-let7e-5p CGCTGAGGTAGGAGGTTGTATAGT. - https://doi.. - org/10.1249/MSS . - https://doi.org/10.1161/CIRCULATIONAHA . - https://doi.org/10.1186/s z.. - https://doi.org/10.1038/ncomms14063.. - https://doi.org/10.1152/physrev . - https://doi.org/10.1089/rej.2007.0576.. - https://doi.org/10.1016/S . - https://doi.org/10.1016/j.cellsig . - https://doi.org/10.1002/emmm.201302647.. - https://doi.org/10.1016/j.cub . - https://doi.org/10.101 6/j.jshs . - https://doi.org/10.1111/acel.12636.. - org/10.1007/s . - https://doi.org . - https://doi.org/10.1093/nar/. - https://doi.org/10.1093/gerona/gls131.. - https://doi.org/10.1038/nrg3198.. - https://doi.org/10.18632/aging.1 00603.. - https://doi.org/10.1007/s . - https://doi.org/10.1111/. - https://doi.org/10.1186/s . - https://doi.org/1 0.1111/acel.12469.. - https://doi.org/10.18632/aging.101270.. - https://doi.org/1 0.1371/journal.pone.0106314.. - doi.org/10.18632/oncotarget.22130.. - https://doi.org/10.5812/hepatmon.33881.. - https://doi.org/10.1016/bs.vh . - https://doi.org/10.1016/j.a psb . - https://doi.org/10.1 8632/aging.100276.. - https://doi.org/10.1152/physiolgenomics . - https://doi.org/10.1093/nar/gkw1092.. - https://doi.org/10.1093/nar/28.1.27.. - org/10.1152/physiolgenomics . - https://doi.org/10.1016/j.. - https://doi.org/10.1016/j.exger . - doi.org/10.1016/j.jnutbio . - https://doi.org/10.1016/j.cmet . - org/10.1016/j.fob . - https://doi.org/10.18632/. - org/10.1038/srep38513.. - https://doi.org/10.1261/rna.2332406.. - https://doi.org/10.7554/. - The microRNA.org resource: targets and expression. - https://doi.org/10.1093/nar/gkm995.. - https://doi.org/10.1093/bioinformatics/. - https://doi.org/10.1371/journal.pone.0080747.
Xem thử không khả dụng, vui lòng xem tại trang nguồn hoặc xem
Tóm tắt