- Results: We used next-generation high throughput sequencing to reveal the expression profiles of mRNAs and lncRNAs in IBV-infected HD11 cells. - Compared with the uninfected cells, we identified 153 differentially expressed (DE) mRNAs (106 up-regulated mRNAs, 47 down-regulated mRNAs) and 181 DE lncRNAs (59 up-regulated lncRNAs, 122 down-regulated lncRNAs) in IBV-infected HD11 cells. - Avian infectious bronchitis (IB) is a highly contagious viral disease of chicken caused by infectious bronchitis virus (IBV). - Next, an in vitro study demon- strated that gga-miR-30d inhibited IBV replication in HD11 cells by targeting USP47 [16], whereas miR-146a- 5p promoted IBV replication in HD11 cells by targeting IRAK2 and TNFRSF18 [17].. - We further analyzed the expression patterns of lncRNAs and mRNAs in IBV-infected HD11 cells using next-generation high throughput sequencing techniques.. - Moreover, a ceRNA network based on gga-miR-30d and miR-146a-5p was established.. - Replication status of IBV in HD11 cells. - The expression of non-coding RNAs (ncRNAs) in cells is closely related to the stage of virus infection [13]. - RNA libraries establishment and lncRNA identification Total RNA was extracted from 36 h post-infected HD11 cells (Exp 1, 2, and 3) and mock-infected cells (CK 1, 2, and 3). - 1 Indirect immunofluorescence assay (IFA) of HD11 cells infected by IBV. - Expression profiles of lncRNAs and mRNAs in IBV-infected HD11 cells. - 4) revealed that compared with the control group, the expression profiles of lncRNAs and mRNAs changed significantly after 36 h of IBV infection.. - Pathway analysis of regulated lncRNAs and mRNAs after IBV infection in HD11. - We screened the DEGs related to innate immunity in HD11 cells infected with IBV for 36 h. - For ex- ample, lncRNA MSTRG.14220.1 and MSTRG.21445.2 (Additional File 5) were related to at least 10 or 11 im- mune genes, and they were speculated to function in im- mune regulation in HD11 cells.. - We have previously reported that miR- 146a-5p and gga-miR-30d had significant regulatory roles in IBV infection in HD11 cells [16, 17]. - (B) Distribution of the number of transcripts in lncRNAs and mRNAs in chicken HD11 cells. - (C) Distribution of the number of exons in lncRNAs and mRNAs in chicken HD11 cells. - (D) Distribution of transcript lengths in lncRNAs and mRNAs in chicken HD11 cells. - In addition, eight lncRNAs (MSTRG.8180.7, MSTRG.4755.14, MSTRG.22271.3, MSTRG.21445.2, MSTRG.15550.10, ENSGALT ENSGALT and ENSGALT were found to interact with both miR-146a-5p and gga-miR-30d (Fig. - To validate the high-throughput sequencing results, we performed qPCR to detect the expression of lncRNAs and mRNAs in HD11 cells. - reported that the IBV Beaudette strain could be serially passaged in HD11 cells. - Exp (IBV infected HD11 cells) vs CK (mock infected HD11 cells) (A, C) Heat map and M-A map for mRNAs expression in control and IBV-stimulated avian HD11 cells at 36 h post-infection. - (B, D) Heat map and M-A map for lncRNAs in control and IBV-stimulated avian HD11 cells at 36 h post-infection. - ASCC1 ENSGALG MSTRG.25416.43. - MSTRG.2137.11 HPGDS BDH1A. - MSTRG.6458.14 C1QBP TMED10. - MSTRG.25256.5. - ENSGALG CREBRF ENSGALG MSTRG.2137.5. - MSTRG.14220.1 SLC9A8. - MSTRG.21445.2 RPL12. - MSTRG.27094.4 RBM47 EHD3 ENSGALT00000107274. - MSTRG.26120.58. - 5 Co-expression network of DE lncRNAs and mRNAs based on Pearson ’ s correlation coefficient. - The top 10 DE lncRNAs and their 50 most frequently altered relative mRNAs with 174 connection edges in IBV-infected HD11 cells are shown. - In the present study, we studied the mRNA–lncRNA regulatory network follow- ing IBV infection of HD11 cells.. - We conducted in vitro studies to assess the changes in the expression of genes related to innate immunity in IBV-infected HD11 cells using high- throughput sequencing. - We stud- ied the lncRNA-related immune response in IBV- infected HD11 cells. - LncRNAs, such as lncRNA MSTRG.14220.1 (predicted target genes: ACO1, ELAV L1 , CD81 , HMGB1 , ZC3H12A , ANGPT1 , CBL , IFNA R1, CLTC, and PTPN2) and MSTRG.21445.2 (pre- dicted target genes: JMJD6, CXCR1, S100A9, SQST M1, CTNND1, MYH9, ANKRD17, PPP1CA, PLK1, RAD21, and C1QBP), are believed to participate in IBV infection by regulating innate immune response genes.. - In this study, we analyzed the expression patterns of lncRNAs in IBV-infected and mock-infected HD11 cells using RNA sequencing. - 7 The interaction network of 10 DE lncRNAs and immune-related targets in IBV-infected chicken HD11 cells. - MSTRG.4074.5 MSTRG.11437.17. - MSTRG.4074.6 gga-miR-146a-5p MSTRG.1579.4. - MSTRG.4074.4. - MSTRG.17145.106. - MSTRG.8180.7. - MSTRG.27094.4. - MSTRG.993.2. - ENSGALT MSTRG.12602.1. - MSTRG.8517.2 gga-miR-30d. - MSTRG.9359.3. - MSTRG.21635.1 ENSGALT00000101150. - MSTRG.25416.43. - MSTRG.993.3 MSTRG.16094.3. - MSTRG.25092.11. - MSTRG.17935.12. - MSTRG.25416.41 MSTRG.2824.2. - MSTRG.3559.1 MSTRG.12602.4. - MSTRG.4755.14. - MSTRG.2424.5 ENSGALT00000095670. - MSTRG.25092.8 MSTRG.9359.1 ENSGALT00000094718. - MSTRG.25092.7 MSTRG.15550.10 MSTRG.21445.2. - MSTRG.22271.3. - MSTRG.11437.13 MSTRG.15649.6. - MSTRG.10068.2. - MSTRG.25373.1 MSTRG.17307.22. - MSTRG.8519.2 MSTRG.15811.5. - MSTRG.7587.15. - MSTRG.20533.5. - MSTRG.15141.2. - MSTRG.16758.6. - MSTRG.2850.6. - MSTRG.19505.3. - MSTRG.10068.9 MSTRG.25436.3. - MSTRG.3765.1. - The expression of the lncRNAs in the picture had changed significantly in IBV-infected HD11 cells, and they were predicted to interact with miRNAs at the nucleic acid sequence level. - MSTRG.7587.19 GACCGTCGTGAGACAGGTTAGT CTCCTCAGCCAAGCACATACAC. - MSTRG.22271.3 GCAACTTCCAGAGACCACAGAA CTCCAGCCACCAAGCACAAC. - MSTRG.9359.1 GCTACCAAGCAATGTGTTCCAC AGTGAGGCAAGTGAGGAGAAGG. - MSTRG.6458.14 GGTGTGGCTGGTGGACTGTA AGCCGCACCTGTAGTGAGAC. - MSTRG.26120.58 ACGACATTAGGCGGTACGGAAT GAGGCTGGAGTGGCACAAGA. - Interestingly, we found that the majority of DE-lncRNAs, such as MSTRG.25416.43, MSTRG.6458.31, and MSTR G.24743.3, whose target genes (TARDBP, FMR1, and TRIM8) were mainly enriched in terms related to nu- cleic acid and protein metabolism, and not to terms re- lated to immunity (although certain virus-related terms were also been enriched). - Previously, we demon- strated that gga-miR-30d inhibited IBV replication in HD11 cells by targeting USP47 [16]. - MiR-146a-5p pro- moted IBV replication in HD11 cells by targeting IRAK2 and TNFRSF18 [17]. - We further analyzed the changes in lncRNAs in IBV-infected HD11 cells. - For example, lncRNA MSTRG.21445.2, identi- fied as a lncRNA with a length of about 4000 bp in our study, was significantly up-regulated following IBV infec- tion. - LncRNA MSTRG.21445.2 regulates IBV infection by competing with mRNAs of USP47, IRAK2, and TNFRSF18 for gga-miR-30d and miR-146a- 5p. - We performed a comprehensive analysis of lncRNA and mRNA expression profiles in HD11 cells follow- ing IBV infection using RNA sequencing. - lncRNAs MSTRG.14220.1, MSTRG.21445.2, MSTR G.25416.43, MSTRG.6458.31, and MSTRG.24743.3.. - HD11 cells were divided into two groups with three bio- logical replicates in each group: cells infected with IBV represented the experimental group (Exp 1, 2, and 3);. - mock-infected HD11 cells served as control (CK 1, 2, 3).. - filtered reads were mapped onto the reference genome using HISAT2 (2.1.0), the default mismatch was no more than two. - Briefly, IBV-infected or mock-infected HD11 cells were incu- bated with mouse anti-IBV N protein monoclonal anti- body (Novus Biologicals, USA) at 37 °C for 2 h. - IBV: infectious bronchitis virus. - IB: infectious bronchitis. - Coronavirus avian infectious bronchitis virus. - Li H, Li JN, Zhai YR, Zhang L, Cui PF, Feng L, Yan WJ, Fu X, Tian YM, Wang HN et al: Gga-miR-30d regulates infectious bronchitis virus infection by targeting USP47 in HD11 cells. - Han XX, Tian YM, Guan R, Gao WQ, Yang X, Zhou L, Wang HN: Infectious Bronchitis Virus Infection Induces Apoptosis during Replication in Chicken Macrophage HD11 Cells. - Activation of the Chicken Type I Interferon Response by Infectious Bronchitis Coronavirus. - BISPR is induced by IFN and regulates the expression of the antiviral factor tetherin
Xem thử không khả dụng, vui lòng xem tại trang nguồn hoặc xem
Tóm tắt