- Expression of Zinc Finger Protein Zat12 from Arabidopsis thaliana in Escherichia coli. - The C2H2 zinc finger protein ZAT12 has been classified as a plant core abiotic stress response gene in the early response to multiple stresses. - For further research on the regulation of the ZAT12 protein in planta, a huge quantity of ZAT12 proteins is required to inject into mice for the generation of ZAT12 antiserum.. - In this study, the gene encoding the ZAT12 protein from Arabidopsis thaliana was cloned into the expression vector - pETBlue-2 and then overexpressed in E. - ZAT12, zinc finger protein, ZAT12 expression. - The zinc finger of Arabidopsis thaliana 12 (ZAT12), a member of the C2H2-type plant-specific zinc (Zn) finger transcription factor family (Englbrecht et al., 2004. - Miller et al., 2008. - Kiełbowicz-Matuk, 2012), contains an EAR motif and is thought to function as a repressor of gene expression (Kagale et al., 2010). - ZAT12 was identified among genes induced by light (Iida et al., 2000. - Davletova et al., 2005b), low temperatures (Fowler. - Kreps et al., 2002. - Vogel et al., 2005), wounding (Cheong et al., 2002), osmotic and salinity stress (Kreps et al., 2002), and oxidative stress (Rizhsky et al., 2004. - Davletova et al., 2005b. - Vanderauwera et al., 2005). - ZAT12 is also the direct target of many transcriptional regulators such as EIN3, bZIP29, AtUSB1, DRM2, At3g03170, and LEA18 (Peng et al., 2014. - Ben Daniel et al., 2016). - However, the role of the ZAT12 protein in the abiotic stress signaling network has not been fully elucidated.. - Using a yeast two-hybrid assay and BiFC, the EAR motif was demonstrated to be necessary for the interaction between FIT and ZAT12 (Le et al., 2016). - The expression of the FIT gene was upregulated in zat12 loss-of- function plants. - In addition, these plants accumulated a higher amount of iron compared to the wild type. - ZAT12-GFP fluorescence was detected in Arabidopsis roots, where it could be observed in the nuclei. - These functions of the ZAT12 protein were only demonstrated using a ZAT12-GFP protein with a GFP antibody in immunoblot experiments (Le et al., 2016). - To verify this native ZAT12 function, i.e to monitor Fe dependent expression and the regulation of ZAT12 protein in planta, it is necessary to generate an anti ZAT12 antibody. - To do this, we have conducted a series of experiments including the cloning, transformation, heterologous expression, and purification of the recombinant protein. - In this study, the ZAT12 recombinant protein was successfully expressed in E. - the expression of the ZAT12 protein. - Other standard microbial and recombinant techniques used throughout this work were as described by Sambrook et al. - Generation of the ZAT12-His gene constructs using PCR. - The coding sequence of ZAT12 from Arabidopsis thaliana was amplified by PCR using the primer combination 5’ ZAT12_PET (5’-ATGGTTGCGATATCGGAGATCAA – 3’) (Figure 2) and ZAT12_CT His 3’ (5’- TCAAGAGGCCATACCGTGATGATGATGA TGATGAGAACCACGATAAACTGTTCT TCCAAGCTCCA -3’) (Le et al., 2016). - After checking the size of these fragments by agarose electrophoresis, the ZAT12-His fragments were purified and cloned into the EcoRV cloning site of the pETBlue-2 vector using the Perfectly Blunt® Cloning Kit.. - The recombinant plasmid was transformed into NovaBlue Singles™ Competent Cells (Novagen, USA). - The insertion of ZAT12-His into the pETBlue-2 vector leads to the disruption of the expression of the lacZ α-peptide, and thereby produces white colonies on plates supplemented with X-gal and IPTG (Isopropyl-β-D_thiogalactoside from Roth, Karlsruhe, Germany). - After that, the recombinant plasmid was transformed into Tuner (DE3) pLacI cells and the recombinant protein induction was performed according to the manufacturer’s instructions (Novagen, USA).. - Protein electrophoresis and Immuno Blot Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed to determine the molecular mass of the protein using 10% gels (Laemmli et al., 1970).. - Map of the pETBlue-2-vector. - Overview of the pETBlue-2-vector map with multiple cloning sites. - Schematic view of the amplified fragment for cloning and colony PCR. - The ZAT12 full DNA sequence was amplified using the 5’ZAT12_PET and ZAT12_CT His 3’ primers. - The 6x His Tag was added to the reverse primer. - of the amplified fragment indicated the length of the ZAT12 full DNA with 6x His sequence. - The size of the colony PCR product was amplified using the 5’ ZAT12_PET and pETBlue Down primers (from Novagen) after transformation.. - After Ponceau S staining, the membrane region containing the ZAT12 antigen was cut off as a strip. - For the detection of the ZAT12-His protein, His antibodies and freshly purified undiluted anti- ZAT12 mouse antiserum were applied. - The ZAT12-His protein was detected by incubation with His rat antibody (1:1000 Roche, Germany) and a secondary antibody anti-rat IgG (whole molecule)-horse radish peroxidase conjugate (1:10000, Sigma-Aldrich, USA).. - (Biorad, USA) according to the manufacturer’s protocol.. - Based on the predicted antigenic propensity scores, a peptide corresponding to the N-terminal of ZAT12 was chemically synthesized and conjugated with KLH (Bio Trend) and later injected into mice to obtain a polyclonal antiserum (this work was conducted by Prof. - To generate the recombinant plasmid, the full-length DNA sequence of ZAT12 was specifically amplified with the ZAT12-PET and ZAT12-CT-His primers, which produced an expected band of 538bp. - sequencing of the selected recombinant plasmid was performed to confirm the proper orientation of the insert by ligation (Figure 3).. - Resultant colonies were tested for the presence of the recombinant plasmid by colony PCR, and colonies were numbered as 1, 2, 3. - If the insert was in the correct orientation, the expected size of the PCR product for ZAT12 with the primer combination (ZAT12 5' and pETBlueDOWN, see Figure 2) was approximately 800bp (538bp of ZAT12 full plus 232bp from the pET Blue2 vector). - 8 of ZAT12 gave a PCR product at the expected size.. - Expression of ZAT12 protein. - Upon successful expression of the recombinant 18kDa ZAT12- His fusion protein at a small scale level, a large scale expression of ZAT12 protein was performed.. - Preparation of the ZAT12 encoding gene. - The DNA fragment of ZAT12-His using PCR. - Amino acid changes at the 5’-ends of ZAT12 introduced via PCR. - Colony-PCR of ZAT12-His colonies was performed on 10 colonies.. - 8 gave a PCR product at the expected size,. - SDS-PAGE analysis of the heterologously expressed recombinant ZAT12 fusion protein in E. - Specificity test of the ZAT12 protein. - coli expressing the ZAT12 fusion protein (Figure 5). - We detected a single band on western blot that matched to the specifically expressed and desired ZAT12 protein so that we were able to conclude that the ZAT12 protein was expressed successfully in E. - The C2H2-type plant-specific zinc finger transcription factor family was defined by the presence of a conserved zinc finger domain, in. - At5g59820 was identified among the genes belonging to this family and named ZINC FINGER OF ARABIDOPSIS THALIANA12 (ZAT12). - Structural analysis of the ZAT12 protein showed that it constituted of 162 amino acids divided into two C2H2-type zinc finger domains with a 22-amino acid inter- finger region, and a LDLSL core sequence of the EAR motif localized at the C terminus from amino acid 143 (Meissner &. - Englbrecht et al., 2004. - Kagale et al., 2010). - In plants, the ethylene-responsive element binding factor associated with the Amphiphilic Repression (EAR) motif is a transcriptional regulatory motif found as an active repressor in members of the ERF, C2H2, and AUX/IAA families, among others (Kagale et al., 2010).. - Specificity of the ZAT12 protein. - indicates the position of the ~18kDa ZAT12 fusion protein band (from ZAT12 full gene plus 6 His tags).. - At5g59820 was identified to be a homolog of the Indica rice ZOS3-22 (Os03g0820400, LOC_Os03g6057, ZFP37). - The coding sequence of ZAT12 from Arabidopsis thaliana was amplified using touch- down PCR. - The annealing temperature of 58ºC was suitable for amplification of the ZAT12 gene. - Determination of the optimum annealing temperature for PCR is very important because total genomic DNA extracted from Arabidopsis thaliana was used as a template for ZAT12 amplified PCR (Rychlik et al., 1990). - The fragment was a band with a size of 538bp, similar to the expected ZAT12 fragment size suggesting successful amplification of Zat12 from Arabidopsis thaliana genomic DNA using ZAT12_PET and ZAT12_CT His primers at the annealing temperature of 58°C.. - The transformed Nova Blue bacterial cells were selected using 100 µg mL -1 tetracycline due to the presence of the tetracycline resistance gene in pETBlue-2. - Colony PCR on the randomly selected bacterial colonies was conducted using the primers ZAT12 5' and pETBlue DOWN which binds to the vector downstream of the. - Also, the amplified fragment was approximately 800bp, consisting of 538bp of ZAT12 full and 272bp from the pET Blue2 vector. - This assumption was tested through isolation of the plasmid from colony coded 8, which was followed by sequencing. - The results agreed with the gene map published in the pETBlue-2 Cloning Kits User Manual. - Hence, the results suggested that Zat12 was inserted into the cloning site of pETBlue-2 at the desired orientation. - The converted sequence of ZAT12 showed the ZAT12 sequence-tagged 6x His had a band with a size of 1kb (refer to Figure 3). - The results further confirmed that these plasmid DNA samples were pENTR ™ /D-TOPO ® with Zat12 inserted in the cloning site at the desired orientation. - A high expression level of the ZAT12 protein was indicated by SDS-PAGE and Immunoblot. - specificity of ZAT12 showed that ZAT12 was expressed successfully in E. - Recombinant ZAT12 was expressed successfully in E.coli. - This study helped accumulate enough ZAT12 recombinant protein for immunizing/injecting into mice in the following study of ZAT12 antibody generation.. - The author would like to convey his her deep thanks to the Laboratory of Botany, Faculty of Biosciences, University, Saarbrueken, Germany for their kind hospitality and support in conducting this study. - Plant Identification of novel transcriptional regulators of Zat12 using comprehensive yeast one-hybrid screens. - The zinc finger network of plants. - The zinc-finger protein Zat12 plays a central role in reactive oxygen and abiotic stress signaling in Arabidopsis. - Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. - Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. - A zinc finger protein RHL41 mediates the light acclimatization response in Arabidopsis. - Involvement of plant C(2)H(2)-type zinc finger transcription factors in stress responses. - Zinc finger of Arabidopsis thaliana 12 (ZAT12) interacts with FER-LIKE IRON DEFICIENCY- INDUCED TRANSCRIPTION FACTOR (FIT) linking iron deficiency and oxidative stress responses.. - Isolation and characterisation of a diverse family of Arabidopsis two and three-fingered C2H2 zinc finger protein genes and cDNAs. - The zinc finger protein Zat12 is required for cytosolic ascorbate peroxidase 1 expression during oxidative stress in Arabidopsis. - Optimization of the annealing temperature for amplification in vitro. - Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis
Xem thử không khả dụng, vui lòng xem tại trang nguồn hoặc xem
Tóm tắt