- Comparative analyses of copy number variations between Bos taurus and Bos indicus. - Background: Bos taurus and Bos indicus are two main sub-species of cattle. - Results: Based on the new high-quality cattle reference genome ARS-UCD1.2, we identified 13,234 non-redundant CNV regions (CNVRs) from 73 animals of 10 cattle breeds (4 Bos taurus and 6 Bos indicus. - While 6990 CNVRs (52.82%) were shared by Bos taurus and Bos indicus , large CNV differences were discovered between them and these differences could be used to successfully separate animals into two subspecies.. - Moreover, we obtained 1.74 Mbp indicine-specific sequences, which could only be mapped on the Bos indicus reference genome UOA_Brahman_1. - This CNV overlapped genes related to muscle cell differentiation, which might be generated from a retropseudogene of CTH but was deleted along Bos indicus lineage.. - Conclusions: This study presents a genome wide CNV comparison between Bos taurus and Bos indicus . - It supplied essential genome diversity information for understanding of adaptation and phenotype differences between the Bos taurus and Bos indicus populations.. - In cattle, Bos taurus and Bos indicus are two main subspe- cies that supply beef and milk for human daily life in the whole world. - Large differences exist between them in terms of the phenotypes and geographical distributions [1]. - Bos indicus has prominent hump and shows stronger resistances to heat, drought and diseases [2]. - All of these illustrated large differences between Bos taurus and Bos indicus in their genomes, and many variations were probably associated with their spe- cific phenotypes [9].. - We previously com- pared CNV between the Nellore (one Bos indicus breed) and Bos taurus using the BoivneHD SNP array, and re- ported 1.22 Mbp lineage-specific genome sequences [15].. - Combining different strategies could greatly increase the accuracy of the CNV detection. - For example, two previous CNV stud- ies for the differences between Bos taurus and Bos indicus were performed based on the RD strategy [12, 16]. - In this study, we combined the advantages of the CNVnator (RD strategy) and LUMPY (SR and PEM strategies) to detect and compare CNVs in 73 animals of 10 cattle breeds based on the newly updated high- quality cattle reference genome (ARS-UCD1.2). - Our study will be helpful for understanding of adaptation and phenotype differences between Bos taurus and Bos indicus on the genome-wide level.. - Angus Bos taurus Europe PRJNA343262, PRJNA256210, PRJNA176557, PRJNA513064. - Boran Bos indicus African PRJNA312138. - Brahman Bos indicus Asian PRJNA432125. - Gir Bos indicus Asian PRJNA277147. - Hereford Bos taurus Europe PRJNA343262, PRJNA176557. - Kenana Bos indicus African PRJNA312138. - Nelore Bos indicus Asian PRJNA507259, PRJNA277147. - Ogaden Bos indicus African PRJNA312138. - N ’ dama Bos taurus African PRJNA604048. - Muturu Bos taurus African PRJNA604048. - To detect the effects of the high variable CNVR on the. - c One example of the CNV altering gene coding sequences. - Track 1: gene structure of the cattle FGL1 gene. - S1a): Europe Bos taurus (Angus and Hereford), African Bos taurus (N’dama and Muturu), Asian Bos indicus (Brahman, Gir and Nelore), African Bos indicus (Boran, Kenana and Ogadan) [33]. - This was supported by the PCA result that the PC1 was successfully divided the sam- ples of Bos taurus from those of Bos indicus (Fig. - At K = 2, the Bos taurus were separated with the Bos indicus . - At K = 3, the Asian Bos indicus showed a clear separation from the other groups. - At K = 4, the Bos taurus were separated to Europe Bos taurus and African Bos taurus. - Differential CNV segments between Bos taurus and Bos indicus. - It is of note that the percentage of deletions was higher in Bos indicus than that in Bos taurus (Figure S2). - This is likely related to the genome reference bias, and could reveal the existence of the sub-species-specific sequences for Bos indicus . - We isolated unmapped reads for the Bos indicus cattle and successfully re-mapped them on the reference genome of the Bos indicus (UOA_Brahman_1) [12]. - We compared the CNVRs between Bos taurus and Bos indics . - Large differences were found between them in terms of the CNVR distribution and status. - Bos indicus contained more CNVRs (both number and. - length) per animal as compared to Bos taurus (Figure S3). - We detected 2619 and 4293 genes that uniquely overlapped with CNVRs of either Bos taurus or Bos indi- cus , respectively (Figure S4a). - However, we found that the genes overlapped with Bos indicus -specific CNVRs were significantly (FDR <. - To fine map regions under genome selection, we applied a statistics comparison of CNV segments between Bos taurus and Bos indicus at a global level, using F-statistics.. - It is of note that all significant CNV seg- ments showed high ratio of deletion in Bos indicus , while no change or normal in Bos taurus (Fig. - 4b), suggesting that they are likely to be specific sequences of the Bos taurus. - Possible regulation mechanism and origin of the top differential CNV. - Interestingly, the top significantly differential CNV segment (chr was not only covered the sec- ond exon of the ENSBTAG gene (uncharac- terized gene), but also located in the intron region of the CTNNA1 gene at the same time (Fig. - We did blast the ENSBTAG sequence against the cattle gen- ome (ARS-UCD1.2) and found that the second exon of the ENSBTAG was actually a retropseudogene of CTH in Bos taurus . - 3 PCA analysis of the ten cattle breeds based on the CNV. - We speculated that this CNV segment (chr may be related to the muscle development difference between Bos taurus and Bos indicus , through regulating ENSBTAG and CTNNA1.. - Next, we used the PCR to check the existence of this CNV segment in 22 Bos taurus (6 Holstein, 4 Jersey, 6 Angus, 6 Hereford) and 19 Bos indicus (6 Nelore, 3 N’dama, 4 Muturu, 6 Brahman). - The result showed that all Bos indicus ani- mals were deletion, while all Bos taurus animals were normal with 2 copies, which confirmed our observation in the genome sequencing analysis. - We further checked the reads mapped on the ENSBTAG using the RNA sequencing data for Bos taurus and Bos indi- cus . - Although we could not clearly distinguish the reads on the second exon that were transcribed from CTH or ENSBTAG we observed few reads mapped on the first exon in Bos Taurus , but not in Bos indicus. - This implied that ENSBTAG might not be expressed in Bos indicus , possibly due to the deletion of the second exon.. - Combined with the spe- cific deletion in the Bos indicus , we speculated that the CTH mRNA insertion might happened before the rumin- ant speciation but lost in the Bos indicus lineage.. - 4 Comparisons of CNV segments between Bos taurus and Bos indicus. - a F ST between Bos taurus and Bos indicus at CNV segment level. - b The rate of the CNV segment status (loss and normal, no gain was found for these CNV segments) in Bos taurus and Bos indicus , and the position of differential CNV segments overlapped with genes. - In the cattle genome, chr23 and chr15 have drawn attention of the CNV studies, because of their enriched major histocom- patibility complex (MHC) genes and olfactory receptor (OR) genes. - In our study, we selected samples of cattle representing four regions: Europe Bos taurus , African Bos taurus , Asian Bos indicus , and African Bos indicus . - African Bos indicus exhibited high levels of shared genetic variation with Asian Bos indicus but not with African Bos taurus , probably because of their recent divergence [33].. - Overall, our population analyses successfully divided the animals into Bos taurus and Bos indicus . - Interestingly, the function of genes in these regions were similar to the genes in Bos indicus -specific CNVRs that were enriched in the regulation of Rho pro- tein signal transduction. - 5 Analysis of the effects of top differential CNV segment on genes and its possible formation history. - a Distribution of the genome sequencing and RNA sequencing reads around the CNV and the affected two genes. - characteristics of Bos indicus [51]. - Using F-statistics, we found 16 lineage-differential CNV segments between Bos indicus and Bos taurus . - We explored the origin for the top lineage-differential CNV between Bos taurus and Bos indicus . - We found this CNV was a retropseudogene of the CTH . - However, it was totally deleted in the Bos indicus . - We speculate that it might be selectively erased during or after the separation of Bos indicus from Bos taurus to better adapt to their environments.. - Large CNV differences were found between Bos taurus and Bos indicus . - We successfully validated the top significant lineage-differential CNV, which might be generated from a retropseudogene of CTH but was deleted along Bos indicus lineage. - Our study supplied essential information to promote the understand- ing of adaptation and phenotype differences between Bos taurus and Bos indicus at the CNV level. - We sampled another 4 N’dama and 3 Muturu from African Bos taurus . - In addition, to analyze the differential CNVs between the two subspecies, we downloaded four liver RNA sequencing data of Bos taurus (SRR1607562 and SRR1607566) and Bos indicus (SRR6798334 and SRR6798339), one whole genome bisul- fate sequencing data (SRX3367857) of the blood genome DNA from the NCBI database. - reverse: ACCATGACAAGCTTACTAGGGGT) based on the newest version of the cattle genome (ARS- UCD1.2). - Additional file 1: Figure S1 Population analysis of the ten cattle breeds using CNV segments. - a: Cluster analysis of the ten cattle breeds using CNV segments. - b: Admixture analysis of the ten cattle breeds using CNV segments.. - Additional file 3: Figure S3 Comparisons of CNV between Bos taurus and Bos indicus.. - Additional file 4: Figure S4 Analyses of genes overlapped with CNVRs in Bos taurus and Bos indicus. - b: Gene ontology analyses for the genes overlapped with CNVRs in Bos taurus and Bos indicus.. - Additional file 5: Table S1 Information of the CNVR in the ten cattle breeds. - Information of the CNV cluster in the cattle genome of the ten cattle breeds. - Information of the genes with their exon overlapped with CNVRs. - Information of the genes overlapped with high frequency (>. - F-statistics com- parison result between Bos Taurus and Bos indicus based on CNV seg- ments (top 1. - The four liver RNA sequencing data of Bos taurus and Bos indicus can be acquired with SRR1607562, SRR1607566, SRR6798334 and SRR6798339, and the one whole genome bisulfate sequencing data of the blood genome DNA can be acquired with SRX3367857 from the NCBI database (https://www.ncbi.nlm.. - Evaluation of attributes that affect longissimus muscle tenderness in Bos taurus and Bos indicus cattle. - Effect of marbling degree on beef palatability in Bos taurus and Bos indicus cattle. - Relationship between shear force and trained sensory panel tenderness ratings of 10 major muscles from Bos indicus and Bos taurus cattle. - Linkage disequilibrium levels in Bos indicus and Bos taurus cattle using medium and high density SNP chip data and different minor allele frequency distributions. - Detection of quantitative trait loci in Bos indicus and Bos taurus cattle using genome- wide association studies. - Guidelines for the nomenclature of the human heat shock proteins. - Crystal structure of the MuSK tyrosine kinase: insights into receptor autoregulation
Xem thử không khả dụng, vui lòng xem tại trang nguồn hoặc xem
Tóm tắt