Genetic variation of dynamic fiber elongation and developmental quantitative trait locus mapping of fiber length in upland cotton (Gossypium hirsutum L.)

- upland cotton ( Gossypium hirsutum L.).
- Background: In upland cotton ( Gossypium hirsutum L.
- Results: A total of and 88 SNPs showed significant correlations with fiber length at and 25 DPA and maturity, respectively.
- Conclusions: This study provides important new insights into the genetic basis of the time-dependent fiber-length trait and reveals candidate SNPs and genes for improving fiber length in upland cotton..
- Upland cotton ( G.
- Cotton fibers are the longest and fastest-growing cells in plants, and each cotton fiber consists of a single cell gen- erated from the epidermal layer of the ovule (seed).
- 2 State Key Laboratory of Cotton Biology, Cotton Institute of the Chinese Academy of Agricultural Sciences, Key Laboratory of Cotton Genetic Improvement, Ministry of Agriculture, Anyang 455000, Henan, China.
- 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0.
- who tested 719 upland cotton accessions in eight environments [10].
- However, most of the QTLs obtained from interspecific populations are not directly applicable to upland cotton improvement because they are localized in very large gen- etic regions, and most are not stable across different populations.
- Because almost all of the FL QTLs identified to date in cotton are for mature fibers, it is currently unknown when and how these QTLs act during the fiber elongation stage..
- Understanding the genetic mechanisms underlying FL at different developmental time points will aid the elucidation of the mechanism of fiber elongation.
- Based on the mature FL data of the most of the upland cotton accessions from public databases and our lab, we selected 83 representative upland cotton lines with a wide range variation of ma- ture FL from different sources or pedigrees.
- The genotypes of the accessions were determined using the Cotton 63 K Illumina SNP array [27].
- A total of 83 upland cotton lines were selected based on a previous GWAS involving approximately 300–700 diverse upland cotton accessions from China, and the seeds were obtained from the National Cotton Germplasm Collec- tions of the Low-temperature Germplasm Gene Bank of the Institute of Cotton Research, Chinese Academy of Agricultural Sciences (CRI-CAAS) (Additional file 1:.
- For verification of the identified QTLs, an interspecific backcross inbred line (BIL) population consisting of 176 lines was used.
- To improve the measurement efficiency and accuracy of the results, only the ovules in the middle of the boll were measured for FL using the water-boiling method [28].
- The standards employed to control the quality of the SNP data were as follows: minor allele frequency.
- A neighbor-joining (NJ) phylogenetic tree was used to assess the genetic diversity of the 93 cotton inbred lines and cultivars.
- The population structure of the 83 upland cotton lines was estimated using a Bayes- ian Markov Chain Monte Carlo model (MCMC) with STRUCTURE 2.3.4 software.
- The length of the burn-in period and number of MCMC replications after burn-in were set to 10,000 and 100,000, respectively.
- The candidate SNPs obtained from the above GWAS of the natural population were first screened for homozygous polymorphisms between CRI36 and Hai7124..
- design for HRM analysis of the BIL populations.
- To reveal the gen- eral pattern of expression of the candidate genes, we an- alyzed transcriptome sequencing data for cotton fiber samples in our laboratory.
- To further verify the expression trends of the candi- date genes, a qRT-PCR analysis was performed.
- Phenotypic variations in dynamic FL among upland cotton accessions.
- The mean coefficients of variation (CVs) for FL at and 25 DPA and maturity were and 6.45%, respectively.
- However, only approximately ½ of the pheno- typic variation in FL was accounted for by the genetic variation at 10 and 15 DPA, indicating that the FL is more influenced by environmental factors during early develop- mental time-points than at later time-points..
- Phenotypic variations in the growth rate of fiber length The growth rates of the fibers between two adjacent periods were further calculated in each of the three tests..
- In contrast, dehydra- tion of the fiber cell led to fiber shortening in maturity, which explains the observed negative AGR from 25 DPA to maturity.
- This result indicated that the fastest AGR preferentially occurred from 10 to 15 DPA in most of the upland cotton accessions.
- Among the 14 upland cotton accessions in Fig.
- This result indicated that the rate of the fastest AGR occurring from 15 to 20 DPA in P1 is higher than that in P2..
- 25 DPA .
- 20 – 25 DPA .
- The mean PIC values of the A and D.
- 25 DPA Genotype .
- 20 – 25 DPA Genotype .
- 1 Trend of AGRs in upland cotton accessions between two adjacent periods at the fast-elongation stage.
- a The fastest fiber growth rate (AGR) occurred from 10 to 15 DPA in 69 upland cotton accessions.
- b The fastest fiber growth rate AGR occurred from 15 to 20 DPA in 14 upland cotton accessions.
- a SNP distribution on the 13 chromosomes of the A subgenome.
- b SNP distribution on the 13 chromosomes of the D subgenome.
- The LD values of the A subgenome, D subgenome and AD genome were 2.1, 1.6 and 1.9 Mb, respectively, and the value of r 2 was half of the maximum value (Fig.
- how- ever, the LD decay on chromosome Dt8 was 2.7 Mb, which was higher than that on other chromosomes of the D subgenome (Table 3).
- This result verified the reliability of the genotyping of the.
- At and 25 DPA and maturity, a total of and 88 SNPs, respectively, showed significant correlations with the FL tested in the three tests (Additional file 3: Figure S2).
- LD decay is the physical distance in the genome at which the value of r 2 is half of the maximum value.
- Among the 60 common SNPs, two and four SNPs were significantly associated with FL at 10 and 15 DPA, respectively, whereas most of the SNPs were found to be associated with FL at 20 or 25 DPA and maturity (Table 4).
- Considering the specific LD decay dis- tance on each chromosome as the QTL confidence interval, these 60 significant SNPs formed 21 QTL re- gions, each of which explained of the phenotypic variation in FL (Table 4)..
- 29.20% of the phenotypic variation for AGR (Table 4)..
- 3 Population structure and linkage disequilibrium (LD) decay of upland cotton accessions.
- b Population structure of 83 upland cotton accessions based on a STRUCTURE analysis with k = 2.
- FL-QTL-1 i43923Gh At DPA a,b , Maturity b,c [16, 22].
- FL-QTL-5 i16326Gh At DPA b,c , 25 DPA a , Maturity b,c [20].
- i01793Gh Dt DPA a,b , Maturity b,c.
- FL-QTL-11 i25898Gh Dt DPA a,b , Maturity a,b [16].
- i06491Gh Dt DPA a,b , Maturity a,b.
- FL-QTL-14 i20045Gh Dt DPA a,b , Maturity a,b,c [20].
- To confirm some of the re- sults from the above analysis, a BIL population of 176 lines and the two parents were sown at three locations in 2016, and phenotypic data for FL at maturity were obtained (Additional file 4: Table S3 and Additional file 5: Figure S3)..
- FL-QTL-15 i14259Gh Dt DPA a,b , Maturity a,b [9].
- i20114Gh Dt DPA a,b , Maturity a,b FL-QTL-16 i60963Gt Dt DPA a,b , Maturity a,b,c FL-QTL-17 i07222Gh Dt DPA b , 25 DPA a,b , Maturity a,b,c.
- FL-QTL-18 i60962Gt Dt DPA a,b , Maturity b,c [9, 10].
- FL-QTL-21 i11417Gh Dt DPA c , 25 DPA b , Maturity a,b [16].
- i33788Gh Dt DPA c.
- i08062Gh Dt DPA a.
- i08063Gh Dt DPA a.
- i11417Gh Dt DPA c.
- Based on the changes in the expression of the genes in developing fibers, seven genes were identified (Fig.
- 4 Genome-wide association study (GWAS) of the fiber length growth rate at the fast-elongation stage.
- The lowercase letters a and b represent Manhattan plots of the GLM for 10 to 15 DPA and 15 to 20 DPA in 2014, respectively.
- the letters c and d represent Manhattan plots of the GLM for 10 to 15 DPA and 20 to 25 DPA in 2015, respectively.
- and e, f and g represent Manhattan plots of the GLM for 0 to 10 DPA, 10 to 15 DPA and 15 to 20 DPA in 2016, respectively.
- qRT-PCR was further performed to examine the expression levels of the seven genes in developing fibers and 25 DPA) in two long-fiber genotypes and two short-fiber genotypes (Fig.
- 5′- ATCAAGTCCGTGCCTTGGAG -3′ and qRT-D13G 2037-R: 5′- GTTGACCGCAAGTTGTTCCC -3′ with the reaction efficiency of 1.03 in the fiber samples, D1 3G2037 exhibited a high expression level in the develop- ing fibers of the four upland cotton genotypes.
- However, the expression trends of the other genes did not show significant differences be- tween the long- and short-fiber genotypes.
- ANOVA and inheritance analysis of the FL trait in upland cotton.
- Moreover, the heritability estimates ( H 2 ) for FL at and 25 DPA and maturity were and 92.45%, respectively (Table 2).
- b Phenotypic effect values of the dynamic fiber length in two long-fiber and two short-fiber cotton varieties.
- QTLs for the dynamic FL trait in upland cotton.
- The phenotypic traits of a plant at maturity, rather than the phenotypic traits at intermediate developmental stages, are commonly used to detect correlated QTLs, and therefore, some of the associated QTLs are missed.
- In this study, we first performed a GWAS of the developing FL trait in natural accessions of upland cotton based on the Cotton 63 K SNP array.
- Most of the QTLs were detected at 20 and 25 DPA and at maturity (Table 4).
- In the present study, a natural population was employed for a GWAS of the dy- namic FL trait in cotton.
- Among the 60 significantly associ- ated SNP loci identified in the GWAS analysis, seven SNPs showed polymorphism in the parents of the BILs.
- To fur- ther verify the reliability of the significantly associated SNP loci, 176 BILs were used for HRM analysis.
- In the current study, significant correlations of the i60962Gt SNP with FL at maturity were verified in 503 and 719 diverse upland cotton accessions (Table 4).
- Alkane hydroxylase MAH1-like is a member of the cytochrome P450 family and plays a key role in the biosynthesis of secondary alcohols or ketones.
- Frequency map of dynamic fiber length in upland cotton in different environments.
- (d) Fiber length at 25 DPA.
- The lowercase letters a through e represent Manhattan plots of the GLM at and 25 DPA and maturity in 2014.
- f through l represent Manhattan plots of the GLM at and 25 DPA and maturity in 2015.
- and m through q represent Manhattan plots of the GLM at and 25 DPA and maturity in 2016, respectively.
- The raw data of the Cotton 63 K Illumina Infinium SNP array used during the current study are available from the corresponding author on reasonable request..
- A specialized outer layer of the primary cell wall joins elongating cotton fibers into tissue-like bundles.
- Population structure and genetic basis of the agronomic traits of upland cotton in China revealed by a genome-wide association study using high-density SNPs.
- A genome-wide analysis of the lysophosphatidate acyltransferase (LPAAT) gene family in cotton: organization, expression, sequence variation, and association with seed oil content and fiber quality.
- Quantitative trait loci analysis of fiber quality traits using a random-mated recombinant inbred population in upland cotton ( Gossypium hirsutum L.
- Dynamic QTL mapping for plant height in upland cotton ( Gossypium hirsutum.
- Sucrose synthase is an integral component of the cellulose synthesis machinery

Xem thử không khả dụng, vui lòng xem tại trang nguồn
hoặc xem Tóm tắt