« Home « Kết quả tìm kiếm

Sequence alignment

Tìm thấy 20+ kết quả cho từ khóa "Sequence alignment"

Câu hỏi ôn tập môn tin học ứng dụng

www.scribd.com

Căn trình tự (sequence alignment) 1. Căn trình tự (sequence alignment) là gì? 2. Thế nào là local alignment, global alignment ? So sánh sự giống và khác nhau. Thế nào là dot matrix method hay dot plot method (phương pháp ma trận điểm) trong căn trình tự ?

chuyên đề 01

www.scribd.com

PHÂN LOẠI •Dựa trên phương pháp so sánh người ta chia ra làm 2loại alignment. Phép alignment trình tự theo hướng toàn cục (Global Sequence Alignment. được áp dụng trên toàn bộ chuỗi trình tự . Thường được sử dụng khi các trìnhtự so sánh có kích thước gần tương đương và các trìnhtự này có độ tương đồng, giống nhau cao. Phép alignment trình tự theo hướng cục bộ (Local Sequence Alignment. được sử dụng trên một phầncủa chuỗi trình tự .

Chloroplast genome sequence of Chongming lima bean (Phaseolus lunatus L.) and comparative analyses with other legume chloroplast genomes

tailieu.vn

MUMmer was used to pair sequence alignment of the chloroplast genome [81]. The chloroplast genome of P.. unguiculata (NC_018051) in the Leguminosae tribe by mVISTA with the shuffle-LAGAN. The number of genes in the P. The relative synonymous codon usage of the P. lunatus chloroplast genome.. Repeated sequences of the P. Simple sequence repeats (SSRs) in the P..

PacBio genome sequencing reveals new insights into the genomic organisation of the multi-copy ToxB gene of the wheat fungal pathogen Pyrenophora tritici-repentis

tailieu.vn

The ToxB loci and flanking sequence regions of 5 kb up- stream and downstream were extracted (including ToxB mRNA transcript) for a nucleotide multiple sequence alignment to determine sequence conservation between the ten loci. Only ToxB6 was truncated in the 5 ′ se- quence region due to the locus location (contig bp). The ToxB 10 kb multiple sequence alignment showed a highly conserved region of 3,170 bp with a large proportion (2.5 kb) highly conserved upstream of ToxB for all ten loci (Fig.

Genome-wide identification and functional characterization of the Camelina sativa WRKY gene family in response to abiotic stress

tailieu.vn

YNS and HLC conceived of the study and performed all the experiments, including the sequence alignment and phylogeny analysis, and they drafted the manuscript.

GLaMST: Grow lineages along minimum spanning tree for b cell receptor sequencing data

tailieu.vn

With these observed sequences, we can easily identify the root sequence of this tree by sequence alignment against known germline BCR segments in the genome [6]. To reconstruct the full lin- eage tree, we need to fill in the unobserved internal nodes and connect them to the observed nodes by direct edges.. Although the root sequence and some of the internal nodes are known, it is still a NP-Complete problem [5].

Systematic analysis of the Capsicum ERF transcription factor family: Identification of regulatory factors involved in the regulation of species-specific metabolites

tailieu.vn

Multiple sequence alignment of the DREB and ERF protein subfamilies. Phylogenetic tree of the pepper ERF family in relation to Arabidopsis. Phylogenetic tree of the pepper ERF family in relation to tomato (137), rice (138) and. CaERF genes identified and characterized in the pep- per. The funding organizations had no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript..

Gioi Thieu Tin Sinh Hoc

www.scribd.com

Sắp dãy (sequence alignment) 814 AGTGTTTGAGCCTCTGTTTGTGTGTAATTGAGTGTGCATGTGTGGGAGTG 863.

Tin Sinh Học

www.scribd.com

Những giải thuật bắt cặp trình tự (sequence alignment) cũng được áp dụng ngay cảtrong quá trình xác định trình tự DNA, là kỹ thuật xác định trình tự đoạn nhỏ (shotgunsequencing). (Kỹ thuật này đã được công ty Celera Genomics sử dụng để xác định trìnhtự genome của vi khuẩn Haemophilus influenza.)

Bai Giang Tin Sinh Hoc

www.scribd.com

Căn nhiều trình tự (multi sequence alignment) 79 7.2.2. Phân tích trình tự axit nuc leic 84 7.2.5. Lắp ráp trình tự 87 7.2.9. Dữ liệu trình tự 99 8.1. Phân tích trình tự 102 8.2.1. So sánh trình tự 102 8.2.2. Phân tích khung đọc mở và vùng trình tự mã hóa 106 8.2.3. Dự đoán và mô phỏng tương tác protein 110 CHƢƠNG 9 113 CĂN TRÌNH TỰ VÀ NGUYÊN LÝ CỦA CĂN TRÌNH TỰ 113 9.1. Giới thiệu về căn trình tự 113 9.2. Nguyên lý của căn trình tự 114 9.3.

A highly mutable GST is essential for bract colouration in Euphorbia pulcherrima Willd. Ex Klotsch

tailieu.vn

The sequence alignment shows that none of the GSTs. The alignment spans a 60 bp region of the CDS containing the (CTTC) 3 SSR motif (represented in red). pekinensis, with a single nucleotide substitution respon- sible for the loss of the third repeat. esculenta showed two CTTC repeat units, with two nucleotide substitutions related to the loss of the third repeat.

The complete chloroplast genome of Stauntonia chinensis and compared analysis revealed adaptive evolution of subfamily Lardizabaloideae species in China

tailieu.vn

Similarly, mauve alignment results re- vealed that no large structural changes such as gene order rearrangements was detected across these eight chloroplast genomes of Lardizabaloideae species (Add- itional file 2), although some inversions were present in LSC and SSC regions in other Ranunculales species, such as Pulsatilla chinensis, Anemone trullifolia, and Anemoclema glaucifolium.. 5 Sequence alignment of eight Lardizabaloideae chloroplast genomes using the mVISTA program with A.

LuanvanCaohoc-PMH

www.scribd.com

Các ph ươ ng pháp gi ả i quy ế t bài toán so sánh trình t ự Hi ệ n nay đ ã có nhi ề u cách ti ế p c ậ n khác nhau c ủ a các nhà nghiên c ứ u v ề v ấ n đề này, Pairwise Sequence Alignment-PSA đ ã đượ c gi ả i quy ế t khá tri ệ t để , tuy nhiên bài toán Multiple Sequence Alignment-MSA d ự a trên ph ươ ng pháp đ ánh giá Sum-of-Pair v ẫ n còn là m ộ t v ấ n đề để ng ỏ . H ầ u h ế t các ph ươ ng pháp gi ả i quy ế t r ấ t t ố t bài toán PSA.

Genome-wide identification and expression analysis of the B-box transcription factor gene family in grapevine (Vitis vinifera L.)

tailieu.vn

(a), (b) and (c) represent the amino acid sequence alignment of the B-box1, B-box2 and CCT domain, respectively. 3 Characterization of grapevine BBX genes. a Phylogenetic analysis of BBX proteins in grapevine. b Distribution of conserved motifs identified in the 25 VviBBX proteins. c Exon-intron structure of grapevine BBX genes. foregoing descriptions of Holub [29], and thus only seg- mental duplication seems to have taken part in the evo- lution of the grapevine BBX gene family.

Genome-wide identification of the 14–3-3 gene family and its participation in floral transition by interacting with TFL1/FT in apple

tailieu.vn

To detect the sequence conservation of 14–3-3 family mem- bers, we performed multiple sequence alignment of the 18 full-length Md14–3-3 protein sequences (Add- itional file 2: Figure S2). 2), the 14–3-3 family members from the six plant species were divided into two major classes (ɛ class and non-ɛ class), as described previously [3].. To understand the expansion patterns of the Md14–3-3 genes in the apple genome, we analyzed tandem and segmental duplications. 3a, four Md14–3-3 genes (MdGF14m/.

One-step generation of a targeted knock-in calf using the CRISPR-Cas9 system in bovine zygotes

tailieu.vn

To further confirm the exact sequence of the three puta- tive alleles, long reads covering each sub-structures of the proposed alleles were subjected to multiple sequence alignment using MAFFT (http://europepmc.org/article/. To improve the quality of alignment, most of the wild-type sequences were trimmed from the reads. The consensus sequence was re-aligned using BLAST to the nr database or the proposed sequences..

Identification of the neuropeptide precursor genes potentially involved in the larval settlement in the Echiuran worm Urechis unicinctus

tailieu.vn

Sequence characteristics of the selected pNPs that may be involved in the regulation of larval settlement in U.. unicinctus is the same as that of the annelid Platynereis dumerilii, while differs from the mollusc Patinopecten yessoensis and the arthro- pod Megabalanus volcano which have 10 mature pep- tides (Fig. Sequence alignment of the bioactive peptides revealed that the sequence similarity among the different mature MIPs in U.

Comprehensive analysis of NAC transcription factor family uncovers drought and salinity stress response in pearl millet (Pennisetum glaucum)

tailieu.vn

Multiple sequence alignment of all putative membrane-associated NAC TFs in pearl millet (proteins with “ PgNAC ” in their names), Setaria italica (proteins with “ Seita. 5 Phylogenetic analysis of pearl millet and Setaria italica. In a previous study, miR529 was shown to regulate resistance to oxidative stress by targeting transcription factor genes in rice [25]. Transcriptomic expression of PgNACs during drought and salinity stress.

Identification, characterization and functional analysis of grape (Vitis vinifera L.) mitochondrial transcription termination factor (mTERF) genes in responding to biotic stress and exogenous phytohormone

tailieu.vn

The CLUSTALX software was then used for multiple sequence alignment analysis in- cluding grape mTERF genes and those from Arabidopsis (AtmTERF) and maize (ZmmTERF) [32]. The VvmTERF genes were classified into clades ground on multiple sequence alignments with those AtmTERF and ZmmTERF genes.. MEME motifs, conserved sequences and subcellular localization analysis of grape mTERF proteins.

GIỚI THIỆU VỀ TIN SINH HỌC

tailieu.vn

HMM in sequence alignment HMM trong bài toán sắp dãy. n = s ố các dãy. Là bài toán quan tr ọ ng c ủ a tin sinh h ọ c và hi ệ n có nhi ề u thu ậ t toán cho đoán nh ậ n gene d ự a trên các gene đã biết như dữ liệu huấn luyện.. Đề cập một số khái niệm cơ bản trong sinh học và tin sinh học, và những bài toán chính của tin sinh học.. Tin sinh học là một l ĩ nh vực quan trọng, đầy thách thức.. Tin sinh học liên quan chặt với data mining and machine learning.